2009

2009. found out in 1986 (27), is among the most common life-threatening tick-borne zoonoses in THE UNITED STATES (31). HME can be an severe febrile illness seen as a headaches, malaise, nausea, myalgia and/or arthralgia and it is followed by leukopenia, thrombocytopenia, anemia, and elevation of hepatic transaminase amounts (38). HME individuals might create a fulminant poisonous or septic shock-like symptoms, particularly people with HIV disease or who are in any other case immunocompromised (39). The tiny amounts of bacterias recognized in the bloodstream and cells of patients claim that the medical disease can be mediated mainly by proinflammatory cytokines (41). HME can be due to causes a fatal disease in SCID mice; the mice develop fulminant hepatitis and display upregulation of tumor necrosis element alpha (TNF-) and interleukin-1 (IL-1), many chemokines, including CXCL2 (Mip2, a mouse homolog of human being IL-8), and chemokine receptors in the inflammatory liver organ (32). The Arkansas stress of induces manifestation of IL-1, IL-8, and IL-10 protein and mRNA in the human being monocytic leukemia cell range THP-1 at 2 and 24 h postexposure, respectively (23). Transcriptome evaluation established induction of IL-1, IL-8, and TNF- in Arkansas-infected THP-1 cells (56). These scholarly research demonstrate that may induce inflammatory cytokines and chemokines upon interaction with mammalian host cells. It is popular that pathogen-associated molecular patterns (PAMPs) such as for example lipopolysaccharide (LPS), flagella, and peptidoglycan have the ability to stimulate cytokines/chemokines by innate immune system cells (14, 37, 45). Although can be a Gram-negative bacterium, these PAMPs aren’t encoded in the genome (10, 25). This shows that the cytokine and chemokine induction by would depend on other styles of PAMPs or the signaling pathway. For instance, ehrlichial ankyrin repeat-containing proteins p200 binds towards the promoter area of 456 sponsor genes, NBP35 including TNF-, and it had been suggested that qualified prospects to transcriptional activation of TNF- (58). PAMPs are identified by the pattern-recognition receptors (PRRs) such as for example Toll-like receptors (TLRs), retinoic acid-inducible gene I-like receptors, and nucleotide-binding oligomerization domain-like receptors (20). Apart from a single record describing an extended disease by of C3H/HeJ mice lacking in TLR4 function (46), the role of PRRs in immunity and pathogenesis is unknown. To research the cytokine induction pathways, in today’s study we established cytokine induction in bone tissue marrow-derived macrophages (BMDMs) from different mouse strains lacking in TLRs or adaptor substances as well as with THP-1 cells in response to Wakulla. To investigate the signaling for IL-8 induction further, we created a luciferase reporter assay program using HEK293 cells that may be contaminated with Wakulla. METHODS and MATERIALS Ehrlichia, antibodies, and reagents. Arkansas and Wakulla strains of had been propagated in DH82 cells as previously referred to (33). Antibodies utilized had been rabbit anti-extracellular controlled kinase (anti-ERK) antibody, mouse anti-phosphorylated ERK monoclonal antibody (both from Cell Signaling, Danvers, MA), and mouse anti-tubulin monoclonal antibody (Santa Cruz, Santa Cruz, CA). Reagents utilized had been manumycin A, BAY43-9006, U0126, Proceed 6983, and bisindolylmaleimide I (all from Calbiochem, NORTH PARK, CA), SN-50 (Enzo Existence Sciences, Farmingdale, NY), chloroquine, and bafilomycin A1 (Sigma, St. Louis, MO). BMDMs. MyD88?/? and TRIF?/? mice, originally produced by S. Akira (Osaka College or university) (1, 50), had been crossbred to create MyD88?/?, TRIF?/?, and MyD88?/? TRIF?/? mice. Wild-type, TLR2?/?, TLR4?/?, IL-1R1?/?, and IL-18R1?/? C57BL/6 mice had been bought from Jackson Lab (Pub Harbor, Me personally). All pet experiments had been performed beneath the pet protocol authorized by the Institutional Pet Care and Make use of Committee (IACUC) in the Ohio State AM-1638 College or university. The mice had been euthanized with CO2 gas, as well as the tibia and femur from the hind limbs had been dissected to get ready bone marrow cells. Cells had been cultured in RPMI moderate with 10% fetal bovine serum, 2 mM l-glutamine (GIBCO-Invitrogen, Carlsbad, CA), 10% conditioned moderate of L929 cells, and 1% antibiotic blend (100 U/ml penicillin, 100 g/ml streptomycin, 0.25 g/ml amphotericin B; GIBCO-Invitrogen) for 5 to seven days. Adherent BMDMs had been gathered and cleaned and seeded in 24-well plates. IL-8 promoter-luciferase create. To construct an IL-8 promoter reporter plasmid, a DNA fragment comprising the human being IL-8 promoter from ?243 to +46 bp (where +1 is the transcriptional start site) (51) was amplified by PCR (Table 1) using genomic DNA purified from THP-1 cells like a template. The PCR product was digested with XhoI and HindIII and put upstream of the luciferase gene between the XhoI and HindIII sites of pGL4.17 (Promega, Madison, WI) to obtain pK666. Table 1. Primer pairs used.Immunol. febrile illness characterized by headache, malaise, nausea, myalgia and/or arthralgia and is frequently accompanied by leukopenia, thrombocytopenia, anemia, and elevation of hepatic transaminase levels (38). HME individuals may develop a fulminant harmful or septic shock-like syndrome, particularly individuals with HIV illness or who are normally immunocompromised (39). The small numbers of bacteria recognized in the blood and cells of patients suggest that the medical disease is definitely mediated mainly by proinflammatory cytokines (41). HME is definitely caused by causes a fatal illness in SCID mice; the mice develop fulminant hepatitis and show upregulation of tumor necrosis element alpha (TNF-) and interleukin-1 (IL-1), several chemokines, including CXCL2 (Mip2, a mouse homolog AM-1638 of human being IL-8), and chemokine receptors in the inflammatory liver (32). The Arkansas strain of induces manifestation of IL-1, IL-8, and IL-10 mRNA and proteins in the human being monocytic leukemia cell collection THP-1 at 2 and 24 h postexposure, respectively (23). Transcriptome analysis also identified induction of IL-1, IL-8, and TNF- in Arkansas-infected THP-1 cells (56). These studies demonstrate that can induce inflammatory cytokines and chemokines upon connection with mammalian sponsor cells. It is well known that pathogen-associated molecular patterns (PAMPs) such as lipopolysaccharide (LPS), flagella, and peptidoglycan are able to induce cytokines/chemokines by innate immune cells (14, 37, 45). Although is definitely a Gram-negative bacterium, these PAMPs are not encoded in the genome (10, 25). This suggests that the cytokine and chemokine induction by is dependent on other types of PAMPs or the signaling pathway. For example, ehrlichial ankyrin repeat-containing protein p200 binds to the promoter region of 456 sponsor genes, including TNF-, and it was suggested that this prospects to transcriptional activation of TNF- (58). PAMPs are identified by the pattern-recognition receptors (PRRs) such as Toll-like receptors (TLRs), retinoic acid-inducible gene I-like receptors, and nucleotide-binding oligomerization domain-like receptors (20). Other than a single statement describing a prolonged illness by of C3H/HeJ mice deficient in TLR4 function (46), the part of PRRs in pathogenesis and immunity is definitely unknown. To investigate the cytokine induction pathways, in the present study we identified cytokine induction in bone marrow-derived macrophages (BMDMs) from numerous mouse strains deficient in TLRs or adaptor molecules as well as with THP-1 cells in response to Wakulla. To further analyze the signaling for IL-8 induction, we developed a luciferase reporter assay system using HEK293 cells that can be infected with Wakulla. MATERIALS AND METHODS Ehrlichia, antibodies, and reagents. Arkansas and Wakulla strains of were propagated in DH82 cells as previously explained (33). Antibodies used were rabbit anti-extracellular regulated kinase (anti-ERK) antibody, mouse anti-phosphorylated ERK monoclonal antibody (both from Cell Signaling, Danvers, MA), and mouse anti-tubulin monoclonal antibody (Santa Cruz, Santa Cruz, CA). Reagents used were manumycin A, BAY43-9006, U0126, Proceed 6983, and bisindolylmaleimide I (all from Calbiochem, San Diego, CA), SN-50 (Enzo Existence Sciences, Farmingdale, NY), chloroquine, and bafilomycin A1 (Sigma, St. Louis, MO). BMDMs. MyD88?/? and TRIF?/? mice, originally developed by S. Akira (Osaka University or college) (1, 50), were crossbred to generate MyD88?/?, TRIF?/?, and MyD88?/? TRIF?/? mice. Wild-type, TLR2?/?, TLR4?/?, IL-1R1?/?, and IL-18R1?/? C57BL/6 mice were purchased from Jackson Laboratory (Pub Harbor, ME). All animal experiments were performed under the animal protocol authorized by the Institutional Animal Care and Use Committee (IACUC) in the Ohio State University or college. The mice were euthanized with CO2 gas, and the femur and tibia of the hind limbs were dissected to prepare bone marrow cells. Cells were cultured in RPMI medium with 10% fetal bovine serum, 2 mM l-glutamine (GIBCO-Invitrogen, Carlsbad, CA), 10% conditioned medium of L929 cells, and 1% antibiotic combination (100 U/ml penicillin, 100 g/ml streptomycin, 0.25 g/ml amphotericin B; GIBCO-Invitrogen) for 5 to 7 days. Adherent BMDMs were AM-1638 harvested and washed and then seeded in 24-well plates. IL-8 promoter-luciferase create. To construct an IL-8 promoter reporter plasmid, a DNA fragment comprising the human being IL-8 promoter from ?243 to +46 bp (where +1 is the transcriptional start site) (51) was amplified by PCR (Table 1) using genomic DNA purified from THP-1 cells like a template. The PCR product was digested with XhoI and HindIII and put upstream of the luciferase gene between the XhoI and HindIII sites of pGL4.17 (Promega, Madison, WI) to obtain pK666. Table 1. Primer pairs utilized for genomic PCR or RT-PCR 16S rRNAAGCAATGCCTCCTGCACCACCAACCCACATCACCCCTCTACCTCHuman GAPDHAGCAATGCCTCCTGCACCACCAACCCGGAGGGGCCATCCACAGTCTHuman TNF-CCCCAGGGACCTCTCTCTAATGAGGTACAGGCCCTCTGATHuman IL-1ACAGATGAAGTGCTCCTTCCAGTCGGAGATTCGTAGCTGGATHuman IL-8CTGCGCCAACACAGAAATTAATTGCATCTGGCAACCCTACMouse GAPDHGGCATTGCTCTCAATGACAATGTGAGGGAGATGCTCAGTGMouse TNF-CATCTTCTCAAAATTCGAGTGACAATGGGAGTAGACAAGGTACAACCCMouse.5B). are normally immunocompromised (39). The small numbers of bacteria recognized in the blood and cells of patients suggest that the medical disease is definitely mediated mainly by proinflammatory cytokines (41). HME is definitely caused by causes a fatal illness in SCID mice; the mice develop fulminant hepatitis and show upregulation of tumor necrosis element alpha (TNF-) and interleukin-1 (IL-1), several chemokines, including CXCL2 (Mip2, a mouse homolog of human being IL-8), and chemokine receptors in the inflammatory liver (32). The Arkansas strain of induces manifestation of IL-1, IL-8, and IL-10 mRNA and proteins in the human being monocytic leukemia cell collection THP-1 at 2 and 24 h postexposure, respectively (23). Transcriptome analysis also identified induction of IL-1, IL-8, and TNF- in Arkansas-infected THP-1 cells (56). These research demonstrate that may stimulate inflammatory cytokines and chemokines upon relationship with mammalian web host cells. It really is popular that pathogen-associated molecular patterns (PAMPs) such as for example lipopolysaccharide (LPS), flagella, and peptidoglycan have the ability to stimulate cytokines/chemokines by innate immune system cells (14, 37, 45). Although is certainly a Gram-negative bacterium, these PAMPs aren’t encoded in the genome (10, 25). This shows that the cytokine and chemokine induction by would depend on other styles of PAMPs or the signaling pathway. For instance, ehrlichial ankyrin repeat-containing proteins p200 binds towards the promoter area of 456 web host genes, including TNF-, and it had been suggested that network marketing leads to transcriptional activation of TNF- (58). PAMPs are acknowledged by the pattern-recognition receptors (PRRs) such as for example Toll-like receptors (TLRs), retinoic acid-inducible gene I-like receptors, and nucleotide-binding oligomerization domain-like receptors (20). Apart from a single survey describing an extended infections by of C3H/HeJ mice lacking in TLR4 function (46), the function of PRRs in pathogenesis and immunity is certainly unknown. To research the cytokine induction pathways, in today’s study we motivated cytokine induction in bone tissue marrow-derived macrophages (BMDMs) from several mouse strains lacking in TLRs or adaptor substances as well such as THP-1 cells in response to Wakulla. To help expand evaluate the signaling for IL-8 induction, we created a luciferase reporter assay program using HEK293 cells that may be contaminated with Wakulla. Components AND Strategies Ehrlichia, antibodies, and reagents. Arkansas and Wakulla strains of had been propagated in DH82 cells as previously defined (33). Antibodies utilized had been rabbit anti-extracellular controlled kinase (anti-ERK) antibody, mouse anti-phosphorylated ERK monoclonal antibody (both from Cell Signaling, Danvers, MA), and mouse anti-tubulin monoclonal antibody (Santa Cruz, Santa Cruz, CA). Reagents utilized had been manumycin A, BAY43-9006, U0126, Move 6983, and bisindolylmaleimide I (all from Calbiochem, NORTH PARK, CA), SN-50 (Enzo Lifestyle Sciences, Farmingdale, NY), chloroquine, and bafilomycin A1 (Sigma, St. Louis, MO). BMDMs. MyD88?/? and TRIF?/? mice, originally produced by S. Akira (Osaka School) (1, 50), had been crossbred to create MyD88?/?, TRIF?/?, and MyD88?/? TRIF?/? mice. Wild-type, TLR2?/?, TLR4?/?, IL-1R1?/?, and IL-18R1?/? C57BL/6 mice had been bought from Jackson Lab (Club Harbor, Me personally). All pet experiments had been performed beneath the pet protocol accepted by the Institutional Pet Care and Make use of Committee (IACUC) on the Ohio State School. The mice had been euthanized with CO2 gas, as well as the femur and tibia from the hind limbs had been dissected to get ready bone tissue marrow cells. Cells had been cultured in RPMI.**, considerably not the same as DMSO control (ANOVA, < 0.01). ERK and NF-B pathways, with no involvement of TLRs and TRIF. INTRODUCTION Individual monocytic ehrlichiosis (HME), uncovered in 1986 (27), is among the most widespread life-threatening tick-borne zoonoses in THE UNITED STATES (31). HME can be an severe febrile illness seen as a headaches, malaise, nausea, myalgia and/or arthralgia and is generally followed by leukopenia, thrombocytopenia, anemia, and elevation of hepatic transaminase amounts (38). HME sufferers may create a fulminant dangerous or septic shock-like symptoms, particularly people with HIV infections or who are usually immunocompromised (39). The tiny amounts of bacterias discovered in the bloodstream and tissue of patients claim that the scientific disease is certainly mediated generally by proinflammatory cytokines (41). HME is certainly due to causes a fatal disease in SCID mice; the mice develop fulminant hepatitis and display upregulation of tumor necrosis aspect alpha (TNF-) and interleukin-1 (IL-1), many chemokines, including CXCL2 (Mip2, a mouse homolog of individual IL-8), and chemokine receptors in the inflammatory liver organ (32). The Arkansas stress of induces appearance of IL-1, IL-8, and IL-10 mRNA and protein in the individual monocytic leukemia cell series THP-1 at 2 and 24 h postexposure, respectively (23). Transcriptome evaluation also motivated induction of IL-1, IL-8, and TNF- in Arkansas-infected THP-1 cells (56). These research demonstrate that may stimulate inflammatory cytokines and chemokines upon relationship with mammalian web host cells. It really is popular that pathogen-associated molecular patterns (PAMPs) such as for example lipopolysaccharide (LPS), flagella, and peptidoglycan have the ability to stimulate cytokines/chemokines by innate immune system cells (14, 37, 45). Although is certainly a Gram-negative bacterium, these PAMPs aren't encoded in the genome (10, 25). This shows that the cytokine and chemokine induction by would depend on other styles of PAMPs or the signaling pathway. For instance, ehrlichial ankyrin repeat-containing proteins p200 binds towards the promoter region of 456 host genes, including TNF-, and it was suggested that this leads to transcriptional activation of TNF- (58). PAMPs are recognized by the pattern-recognition receptors (PRRs) such as Toll-like receptors (TLRs), retinoic acid-inducible gene I-like receptors, and nucleotide-binding oligomerization domain-like receptors (20). Other than a single report describing a prolonged contamination by of C3H/HeJ mice deficient in TLR4 function (46), the role of PRRs in pathogenesis and immunity is usually unknown. To investigate the cytokine induction pathways, in the present study we decided cytokine induction in bone marrow-derived macrophages (BMDMs) from various mouse strains deficient in TLRs or adaptor molecules as well as in THP-1 cells in response to Wakulla. To further analyze the signaling for IL-8 induction, we developed a luciferase reporter assay system using HEK293 cells that can be infected with Wakulla. MATERIALS AND METHODS Ehrlichia, antibodies, and reagents. Arkansas and Wakulla strains of were propagated in DH82 cells as previously described (33). Antibodies used were rabbit anti-extracellular regulated kinase (anti-ERK) antibody, mouse anti-phosphorylated ERK monoclonal antibody (both from Cell Signaling, Danvers, MA), and mouse anti-tubulin monoclonal antibody (Santa Cruz, Santa Cruz, CA). Reagents used were manumycin A, BAY43-9006, U0126, Go 6983, and bisindolylmaleimide I (all from Calbiochem, San Diego, CA), SN-50 (Enzo Life Sciences, Farmingdale, NY), chloroquine, and bafilomycin A1 (Sigma, St. Louis, MO). BMDMs. MyD88?/? and TRIF?/? mice, originally developed by S. Akira (Osaka University) (1, 50), were crossbred to generate MyD88?/?, TRIF?/?, and MyD88?/? TRIF?/? mice. Wild-type, TLR2?/?, TLR4?/?, IL-1R1?/?, and IL-18R1?/? C57BL/6 mice were purchased from Jackson Laboratory (Bar Harbor, ME). All animal experiments were performed under the animal protocol approved by the Institutional Animal Care and Use Committee (IACUC) at The Ohio State University. The mice were euthanized with CO2 gas, and the femur and tibia of the hind limbs were dissected to prepare bone marrow cells. Cells were cultured in RPMI medium with 10% fetal bovine serum, 2 mM l-glutamine (GIBCO-Invitrogen, Carlsbad, CA), 10% conditioned medium of L929 cells, and 1% antibiotic mixture (100 U/ml penicillin, 100 g/ml streptomycin, 0.25.Furthermore, HEK293 cells do not express any TLRs (HEK293 microarray data set, Gene Expression Omnibus [GEO] data set number GDS686) (55), allowing us to analyze TLR-independent signaling pathways associated with Wakulla can activate IL-1, IL-8, and TNF- genes in HEK293 cells (Fig. America (31). HME is an acute febrile illness characterized by headache, malaise, nausea, myalgia and/or arthralgia and is frequently accompanied by leukopenia, thrombocytopenia, anemia, and elevation of hepatic transaminase levels (38). HME patients may develop a fulminant toxic or septic shock-like syndrome, particularly individuals with HIV contamination or who are otherwise AM-1638 immunocompromised (39). The small numbers of bacteria detected in the blood and tissues of patients suggest that the clinical disease is usually mediated largely by proinflammatory cytokines (41). HME is usually caused by causes a fatal illness in SCID mice; the AM-1638 mice develop fulminant hepatitis and show upregulation of tumor necrosis factor alpha (TNF-) and interleukin-1 (IL-1), several chemokines, including CXCL2 (Mip2, a mouse homolog of human IL-8), and chemokine receptors in the inflammatory liver (32). The Arkansas strain of induces expression of IL-1, IL-8, and IL-10 mRNA and proteins in the human monocytic leukemia cell line THP-1 at 2 and 24 h postexposure, respectively (23). Transcriptome analysis also decided induction of IL-1, IL-8, and TNF- in Arkansas-infected THP-1 cells (56). These studies demonstrate that can induce inflammatory cytokines and chemokines upon conversation with mammalian host cells. It is well known that pathogen-associated molecular patterns (PAMPs) such as lipopolysaccharide (LPS), flagella, and peptidoglycan are able to induce cytokines/chemokines by innate immune cells (14, 37, 45). Although is usually a Gram-negative bacterium, these PAMPs are not encoded in the genome (10, 25). This suggests that the cytokine and chemokine induction by is dependent on other types of PAMPs or the signaling pathway. For example, ehrlichial ankyrin repeat-containing protein p200 binds to the promoter region of 456 host genes, including TNF-, and it was suggested that this leads to transcriptional activation of TNF- (58). PAMPs are recognized by the pattern-recognition receptors (PRRs) such as Toll-like receptors (TLRs), retinoic acid-inducible gene I-like receptors, and nucleotide-binding oligomerization domain-like receptors (20). Other than a single report describing a prolonged infection by of C3H/HeJ mice deficient in TLR4 function (46), the role of PRRs in pathogenesis and immunity is unknown. To investigate the cytokine induction pathways, in the present study we determined cytokine induction in bone marrow-derived macrophages (BMDMs) from various mouse strains deficient in TLRs or adaptor molecules as well as in THP-1 cells in response to Wakulla. To further analyze the signaling for IL-8 induction, we developed a luciferase reporter assay system using HEK293 cells that can be infected with Wakulla. MATERIALS AND METHODS Ehrlichia, antibodies, and reagents. Arkansas and Wakulla strains of were propagated in DH82 cells as previously described (33). Antibodies used were rabbit anti-extracellular regulated kinase (anti-ERK) antibody, mouse anti-phosphorylated ERK monoclonal antibody (both from Cell Signaling, Danvers, MA), and mouse anti-tubulin monoclonal antibody (Santa Cruz, Santa Cruz, CA). Reagents used were manumycin A, BAY43-9006, U0126, Go 6983, and bisindolylmaleimide I (all from Calbiochem, San Diego, CA), SN-50 (Enzo Life Sciences, Farmingdale, NY), chloroquine, and bafilomycin A1 (Sigma, St. Louis, MO). BMDMs. MyD88?/? and TRIF?/? mice, originally developed by S. Akira (Osaka University) (1, 50), were crossbred to generate MyD88?/?, TRIF?/?, and MyD88?/? TRIF?/? mice. Wild-type, TLR2?/?, TLR4?/?, IL-1R1?/?, and IL-18R1?/? C57BL/6 mice were purchased from Jackson Laboratory (Bar Harbor, ME). All animal experiments were performed under the animal protocol approved by the Institutional Animal Care and Use Committee (IACUC) at The Ohio State University. The mice were euthanized with CO2 gas, and the femur and tibia of the hind limbs were dissected to prepare bone marrow cells. Cells were cultured in RPMI medium with 10% fetal bovine serum, 2 mM l-glutamine (GIBCO-Invitrogen, Carlsbad, CA), 10% conditioned medium of L929 cells, and 1% antibiotic mixture (100 U/ml penicillin, 100 g/ml streptomycin, 0.25 g/ml amphotericin B; GIBCO-Invitrogen) for 5 to 7 days. Adherent BMDMs were harvested and washed and then seeded in 24-well plates. IL-8 promoter-luciferase construct. To construct an IL-8 promoter reporter plasmid, a DNA fragment containing the human IL-8 promoter from ?243 to +46 bp (where +1 is the transcriptional start site) (51) was amplified by PCR (Table 1) using genomic DNA purified from THP-1 cells as a template. The PCR product was digested with XhoI and HindIII and inserted upstream of the luciferase gene between the XhoI and HindIII sites of pGL4.17 (Promega, Madison, WI) to obtain pK666. Table 1. Primer pairs used for genomic PCR or RT-PCR 16S rRNAAGCAATGCCTCCTGCACCACCAACCCACATCACCCCTCTACCTCHuman GAPDHAGCAATGCCTCCTGCACCACCAACCCGGAGGGGCCATCCACAGTCTHuman TNF-CCCCAGGGACCTCTCTCTAATGAGGTACAGGCCCTCTGATHuman IL-1ACAGATGAAGTGCTCCTTCCAGTCGGAGATTCGTAGCTGGATHuman IL-8CTGCGCCAACACAGAAATTAATTGCATCTGGCAACCCTACMouse GAPDHGGCATTGCTCTCAATGACAATGTGAGGGAGATGCTCAGTGMouse TNF-CATCTTCTCAAAATTCGAGTGACAATGGGAGTAGACAAGGTACAACCCMouse IL-1GGGCCTCAAAGGAAAGAATCTACCAGTTGGGGAACTCTGCMouse CXCL2CTCTCAAGGGCGGTCAAAAAGTTTCAGACAGCGAGGCACATCAGGTA Open in a separate window Stimulation of THP-1 cells and mouse BMDMs..